Stem-loop sequence hsa-mir-8072

AccessionMI0025908 (change log)
Symbol HGNC:MIR8072
DescriptionHomo sapiens miR-8072 stem-loop
Stem-loop
   -   u --a  --au        -  a   a     -   a    
5'  gcg c   ag    ggcggcgg gg ggu ggcag agc gga 
    ||| |   ||    |||||||| || ||| ||||| ||| || c
3'  cgc g   uc    ccgccgcc cc ccg ccguc ucg ccg 
   c   u acc  gccu        a  g   -     g   -    
Get sequence
Deep sequencing
353 reads, 5.88 reads per million, 102 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 123364764-123364843 [-]
sense
OTTHUMT00000400946 ; VPS37B-001; intron 1
OTTHUMT00000400947 ; VPS37B-003; intron 1
OTTHUMT00000400948 ; VPS37B-004; intron 1
ENST00000267202 ; VPS37B-001; intron 1
ENST00000535765 ; VPS37B-003; intron 1
ENST00000371248 ; VPS37B-004; intron 1
Database links

Mature sequence hsa-miR-8072

Accession MIMAT0030999
Sequence

11 - 

ggcggcggggagguaggcag

 - 30

Get sequence
Deep sequencing98 reads, 44 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).