Stem-loop sequence hsa-mir-8070

AccessionMI0025906 (change log)
Symbol HGNC:MIR8070
DescriptionHomo sapiens miR-8070 stem-loop
Stem-loop
   a   g uc -    -     gac    -g    -    -   -gu a 
5'  cuu a  c caug ugauu   ggcu  acuc caug uga   g a
    ||| |  | |||| |||||   ||||  |||| |||| |||   |  
3'  gaa u  g guac acuag   ccga  ugag guac acu   c g
   c   g ga u    u     --u    ag    u    u   agu c 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 11783135-11783222 [-]
intergenic
Database links

Mature sequence hsa-miR-8070

Accession MIMAT0030997
Sequence

11 - 

augugauugacggcugacucca

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).