Stem-loop sequence hsa-mir-8069-1

AccessionMI0025905 (change log)
Previous IDshsa-mir-8069
Symbol HGNC:MIR8069-1
DescriptionHomo sapiens miR-8069-1 stem-loop
Gene family MIPF0002050; mir-8069
Literature search

1 open access papers mention hsa-mir-8069-1
(1 sentences)

Stem-loop
   -----------    u  g   g ag   ga      c  g       a 
5'            cgcc ga cgu c  cag  caucuu cu accuggu a
              |||| || ||| |  |||  |||||| || |||||||  
3'            gcgg cu gcg g  guu  guagga ga uggauua u
   agggacucaau    -  g   g -g   -g      a  g       a 
Get sequence
Deep sequencing
12 reads, 12.5 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 6859171-6859256 [+]
intergenic
Database links

Mature sequence hsa-miR-8069

Accession MIMAT0030996
Sequence

54 - 

ggaugguugggggcggucggcgu

 - 76

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).