Stem-loop sequence hsa-mir-8067

AccessionMI0025903 (change log)
Symbol HGNC:MIR8067
DescriptionHomo sapiens miR-8067 stem-loop
Literature search

1 open access papers mention hsa-mir-8067
(3 sentences)

Stem-loop
   uu   --u     cu    --     aa      --    a 
5'   cug   guuuc  agaa  acugu  acuuag  ucau a
     |||   |||||  ||||  |||||  ||||||  ||||  
3'   gac   cagag  ucuu  ugaca  ugaguc  agua a
   cc   uuu     -u    uc     cg      cu    g 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 62304658-62304734 [-]
sense
OTTHUMT00000256218 ; VPS13C-001; intron 9
OTTHUMT00000416001 ; VPS13C-004; intron 9
OTTHUMT00000415997 ; VPS13C-002; intron 11
OTTHUMT00000416000 ; VPS13C-003; intron 11
ENST00000249837 ; VPS13C-001; intron 9
ENST00000395898 ; VPS13C-004; intron 9
ENST00000261517 ; VPS13C-002; intron 11
ENST00000395896 ; VPS13C-003; intron 11
Database links

Mature sequence hsa-miR-8067

Accession MIMAT0030994
Sequence

11 - 

ccuagaaacuguaaacuuaguc

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).