Stem-loop sequence hsa-mir-8065

AccessionMI0025901 (change log)
Symbol HGNC:MIR8065
DescriptionHomo sapiens miR-8065 stem-loop
Stem-loop
   cag       g     uc    uug     g     uuuuu  g      a 
5'    uacauga agcca  auuu   uuguu uugua     ca caaggc a
      ||||||| |||||  ||||   ||||| |||||     || ||||||  
3'    auguacu ucggu  uaag   gacaa gaugu     gu guuucg g
   uua       -     uu    -uu     g     --ucu  a      g 
Get sequence
Deep sequencing
82 reads, 180 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 5632467-5632566 [+]
sense
OTTHUMT00000435404 ; RP11-420N3.2-001; intron 2
OTTHUMT00000460483 ; RP11-420N3.2-002; intron 2
ENST00000569895 ; RP11-420N3.2-001; intron 2
ENST00000585867 ; RP11-420N3.2-002; intron 2
Database links

Mature sequence hsa-miR-8065

Accession MIMAT0030992
Sequence

67 - 

uguaggaacaguugaauuuuggcu

 - 90

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).