Stem-loop sequence hsa-mir-8064

AccessionMI0025900 (change log)
Symbol HGNC:MIR8064
DescriptionHomo sapiens miR-8064 stem-loop
Stem-loop
   a  -      ------    a  - u     a    a    -   ccau 
5'  ga uggagu      gagc ca c gagcg gcgg cauc cuu    a
    || ||||||      |||| || | ||||| |||| |||| |||    g
3'  cu accuca      cucg gu g cucgc cgcc gugg gaa    u
   c  g      caaacc    -  c c     g    -    c   uaaa 
Get sequence
Deep sequencing
40 reads, 3.7 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 52846463-52846552 [-]
intergenic
Database links

Mature sequence hsa-miR-8064

Accession MIMAT0030991
Sequence

11 - 

agcacacugagcgagcggac

 - 30

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).