Stem-loop sequence hsa-mir-8063

AccessionMI0025899 (change log)
Symbol HGNC:MIR8063
DescriptionHomo sapiens miR-8063 stem-loop
Stem-loop
   u         uucaacagau  g a          -a     aa 
5'  agaggcagu          gu u gacuuuugau  ugaga  u
    |||||||||          || | ||||||||||  |||||   
3'  uuuucguca          cg g cugaggacua  acuuu  u
   -         -------uuu  g g          aa     gg 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 36972821-36972901 [-]
antisense
OTTHUMT00000419744 ; C15orf41-011; intron 3
OTTHUMT00000419747 ; C15orf41-010; intron 4
OTTHUMT00000419741 ; C15orf41-001; intron 5
OTTHUMT00000419742 ; C15orf41-007; intron 5
OTTHUMT00000419745 ; C15orf41-002; intron 5
OTTHUMT00000419746 ; C15orf41-008; intron 5
OTTHUMT00000419749 ; C15orf41-004; intron 5
OTTHUMT00000419748 ; C15orf41-003; intron 6
ENST00000564586 ; C15orf41-011; intron 3
ENST00000566807 ; C15orf41-010; intron 4
ENST00000566621 ; C15orf41-001; intron 5
ENST00000570265 ; C15orf41-007; intron 5
ENST00000437989 ; C15orf41-002; intron 5
ENST00000569302 ; C15orf41-008; intron 5
ENST00000562877 ; C15orf41-004; intron 5
ENST00000338183 ; C15orf41-201; intron 5
ENST00000567389 ; C15orf41-003; intron 6
Database links

Mature sequence hsa-miR-8063

Accession MIMAT0030990
Sequence

50 - 

ucaaaaucaggagucggggcuu

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).