Stem-loop sequence hsa-mir-8062

AccessionMI0025898 (change log)
Symbol HGNC:MIR8062
DescriptionHomo sapiens miR-8062 stem-loop
Stem-loop
   cuuau     ca  ga         ----         c guaa 
5'      gcaug  gu  uuugaggau    uauugcuca g    g
        |||||  ||  |||||||||    ||||||||| |     
3'      cguau  ca  aaacuucug    auaaugagu c    a
   aaucu     -c  ag         uuau         a aaaa 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 7371608-7371692 [+]
intergenic
Database links

Mature sequence hsa-miR-8062

Accession MIMAT0030989
Sequence

11 - 

cagugauuugaggauuauugc

 - 31

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).