Stem-loop sequence hsa-mir-8061

AccessionMI0025897 (change log)
Symbol HGNC:MIR8061
DescriptionHomo sapiens miR-8061 stem-loop
Stem-loop
   -   ag        a    a    -aua  g     ug 
5'  gag  gaugccuu gauu gagg    uu uucag  g
    |||  |||||||| |||| ||||    || |||||   
3'  cuu  uuauggag uuag uucc    ga agguu  g
   a   -g        a    a    gcag  g     ua 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 54645309-54645383 [+]
sense
OTTHUMT00000142117 ; CNOT3-001; intron 1
OTTHUMT00000142129 ; CNOT3-002; intron 1
OTTHUMT00000142130 ; CNOT3-003; 3'UTR (exon 1)
ENST00000221232 ; CNOT3-001; intron 1
ENST00000482247 ; CNOT3-002; intron 1
ENST00000406403 ; CNOT3-003; 3'UTR (exon 1)
ENST00000358389 ; CNOT3-201; intron 1
Database links

Mature sequence hsa-miR-8061

Accession MIMAT0030988
Sequence

11 - 

cuuagauuagaggauauuguu

 - 31

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).