Stem-loop sequence hsa-mir-8060

AccessionMI0025896 (change log)
Symbol HGNC:MIR8060
DescriptionHomo sapiens miR-8060 stem-loop
Stem-loop
   uuuaaa         u  c       -a   -   uca 
5'       uccuguuuu cc acuuacu  uuc ugg   g
         ||||||||| || |||||||  ||| |||   a
3'       aggacagga gg uggguga  aag acc   u
   cgaaaa         -  a       cg   u   cua 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 96359964-96360039 [+]
intergenic
Database links

Mature sequence hsa-miR-8060

Accession MIMAT0030987
Sequence

43 - 

ccaugaagcaguggguaggaggac

 - 66

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).