Stem-loop sequence hsa-mir-8059

AccessionMI0025895 (change log)
Symbol HGNC:MIR8059
DescriptionHomo sapiens miR-8059 stem-loop
Stem-loop
   u       c  g    c  ua      --a      gg a u 
5'  acaggug ag ggaa ug  gaugaa   aggcuu  c c u
    ||||||| || |||| ||  ||||||   ||||||  | |  
3'  uguccac uc uuuu ac  uuacuu   uccgaa  g g g
   u       -  g    -  uc      gac      ag - a 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 50768650-50768730 [+]
intergenic
Database links

Mature sequence hsa-miR-8059

Accession MIMAT0030986
Sequence

11 - 

ggggaacuguagaugaaaaggc

 - 32

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).