Stem-loop sequence hsa-mir-8058

AccessionMI0025894 (change log)
Symbol HGNC:MIR8058
DescriptionHomo sapiens miR-8058 stem-loop
Stem-loop
   u  u  c     --   cu    ca      a      -c   ac  a 
5'  gg ca ugcca  gug  gaga  uuaaag uccagg  ccc  gg g
    || || |||||  |||  ||||  |||||| ||||||  |||  ||  
3'  cc gu auggu  uac  uucu  aguuuc aggucc  ggg  cc a
   u  -  -     aa   cg    --      -      ac   -a  a 
Get sequence
Deep sequencing
32 reads, 8 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 82688931-82689019 [+]
sense
OTTHUMT00000432917 ; CDH13-001; intron 1
OTTHUMT00000432919 ; CDH13-012; intron 1
OTTHUMT00000432920 ; CDH13-011; intron 1
OTTHUMT00000432921 ; CDH13-013; intron 1
OTTHUMT00000432923 ; CDH13-004; intron 1
OTTHUMT00000432924 ; CDH13-003; intron 1
OTTHUMT00000432925 ; CDH13-005; intron 1
OTTHUMT00000432926 ; CDH13-006; intron 1
OTTHUMT00000432927 ; CDH13-014; intron 1
OTTHUMT00000432929 ; CDH13-007; intron 1
OTTHUMT00000432918 ; CDH13-009; intron 2
OTTHUMT00000432928 ; CDH13-010; intron 4
ENST00000566620 ; CDH13-001; intron 1
ENST00000569144 ; CDH13-012; intron 1
ENST00000562601 ; CDH13-011; intron 1
ENST00000568770 ; CDH13-013; intron 1
ENST00000565636 ; CDH13-004; intron 1
ENST00000431540 ; CDH13-003; intron 1
ENST00000428848 ; CDH13-005; intron 1
ENST00000539548 ; CDH13-006; intron 1
ENST00000566333 ; CDH13-014; intron 1
ENST00000567445 ; CDH13-007; intron 1
ENST00000446376 ; CDH13-201; intron 1
ENST00000268613 ; CDH13-009; intron 2
ENST00000569455 ; CDH13-010; intron 4
Database links

Mature sequence hsa-miR-8058

Accession MIMAT0030985
Sequence

58 - 

cuggacuuugaucuugccauaa

 - 79

Get sequence
Deep sequencing30 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).