Stem-loop sequence hsa-mir-8057

AccessionMI0025893 (change log)
Symbol HGNC:MIR8057
DescriptionHomo sapiens miR-8057 stem-loop
Stem-loop
   -         ugu       u   -aa   -    u 
5'  aauuuggga   ggcucug agu   gau ggac u
    |||||||||   ||||||| |||   ||| |||| g
3'  uuaaauuuu   ccgggac ucg   cua cuug c
   a         --u       -   acc   a    g 
Get sequence
Deep sequencing
32 reads, 5.88 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 26591467-26591535 [-]
intergenic
Database links

Mature sequence hsa-miR-8057

Accession MIMAT0030984
Sequence

11 - 

guggcucuguaguaagaugga

 - 31

Get sequence
Deep sequencing26 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).