Stem-loop sequence hsa-mir-8056

AccessionMI0025892 (change log)
Symbol HGNC:MIR8056
DescriptionHomo sapiens miR-8056 stem-loop
Stem-loop
   cu    --u  -        - -c    g    ------u u   u 
5'   ucuc   ga gcauccag c  ucua gagc       g gcc c
     ||||   || |||||||| |  |||| ||||       | |||  
3'   agag   cu cguagguc g  aggu cuug       c cgg c
   uc    uuc  a        u uu    g    uccuuau -   u 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 173347455-173347536 [+]
sense
OTTHUMT00000376285 ; CPEB4-010; intron 1
OTTHUMT00000252964 ; CPEB4-001; intron 2
OTTHUMT00000372808 ; CPEB4-003; intron 2
OTTHUMT00000372807 ; CPEB4-002; intron 2
OTTHUMT00000372809 ; CPEB4-004; intron 2
OTTHUMT00000372932 ; CPEB4-008; intron 2
OTTHUMT00000372810 ; CPEB4-005; intron 2
OTTHUMT00000372811 ; CPEB4-006; intron 2
ENST00000519467 ; CPEB4-010; intron 1
ENST00000265085 ; CPEB4-001; intron 2
ENST00000520867 ; CPEB4-003; intron 2
ENST00000334035 ; CPEB4-002; intron 2
ENST00000519835 ; CPEB4-004; intron 2
ENST00000519152 ; CPEB4-008; intron 2
ENST00000522336 ; CPEB4-005; intron 2
ENST00000517880 ; CPEB4-006; intron 2
Database links

Mature sequence hsa-miR-8056

Accession MIMAT0030983
Sequence

53 - 

cguggauugucuggaugcau

 - 72

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).