Stem-loop sequence hsa-mir-8055

AccessionMI0025891 (change log)
Symbol HGNC:MIR8055
DescriptionHomo sapiens miR-8055 stem-loop
Stem-loop
   uuac      a    --     cuu  -     ------         ga u 
5'     ggucac cugu  gcuca   ug ucaaa      uaaaagaug  g c
       |||||| ||||  |||||   || |||||      |||||||||  | g
3'     cuagug ggca  cgagu   ac aguuu      auuuucugc  u u
   agua      a    ga     -ac  g     cccaca         ag u 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 6622124-6622220 [-]
intergenic
Database links

Mature sequence hsa-miR-8055

Accession MIMAT0030982
Sequence

65 - 

cuuugagcacaugagcagacgga

 - 87

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).