Stem-loop sequence hsa-mir-8054

AccessionMI0025890 (change log)
Symbol HGNC:MIR8054
DescriptionHomo sapiens miR-8054 stem-loop
Stem-loop
   ca      c   -aa      auc   u    ucaauaga       a 
5'   gcaaug aga   guacag   gga gggu        uugcuuu g
     |||||| |||   ||||||   ||| ||||        |||||||  
3'   uguuac ucu   cauguu   ccu uccg        aacgaag c
   uc      -   aua      -ac   -    --------       u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 23419105-23419190 [-]
intergenic
Database links

Mature sequence hsa-miR-8054

Accession MIMAT0030981
Sequence

11 - 

gaaaguacagaucggaugggu

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).