Stem-loop sequence hsa-mir-8053

AccessionMI0025889 (change log)
Symbol HGNC:MIR8053
DescriptionHomo sapiens miR-8053 stem-loop
Stem-loop
   gc     cac      -uuu        --aa     g 
5'   uuuuc   uggcga    uggaacuc    uggca a
     |||||   ||||||    ||||||||    |||||  
3'   aagag   gccguu    auuuugag    acugu a
   aa     aaa      uccu        aaga     a 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 47652669-47652743 [+]
antisense
OTTHUMT00000361682 ; CORIN-002; intron 1
OTTHUMT00000361679 ; CORIN-009; intron 12
OTTHUMT00000361676 ; CORIN-005; intron 12
OTTHUMT00000361674 ; CORIN-003; intron 12
OTTHUMT00000361680 ; CORIN-010; intron 12
OTTHUMT00000216906 ; CORIN-001; intron 13
ENST00000505754 ; CORIN-002; intron 1
ENST00000508498 ; CORIN-009; intron 12
ENST00000502252 ; CORIN-005; intron 12
ENST00000505909 ; CORIN-003; intron 12
ENST00000504584 ; CORIN-010; intron 12
ENST00000273857 ; CORIN-001; intron 13
Database links

Mature sequence hsa-miR-8053

Accession MIMAT0030980
Sequence

11 - 

uggcgauuuuggaacucaauggca

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).