Stem-loop sequence hsa-mir-8052

AccessionMI0025888 (change log)
Symbol HGNC:MIR8052
DescriptionHomo sapiens miR-8052 stem-loop
Stem-loop
   u     g  gcg g     -  ag   a      c 
5'  ggagg cu   g acugu ag  ggc ugagcu a
    ||||| ||   | ||||| ||  ||| ||||||  
3'  ucucc ga   c uggua uc  ccg acucga g
   g     g  --a g     c  ga   g      g 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 130666735-130666803 [+]
intergenic
Database links

Mature sequence hsa-miR-8052

Accession MIMAT0030979
Sequence

11 - 

cgggacuguagagggcaugagc

 - 32

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).