Stem-loop sequence hsa-mir-7978

AccessionMI0025754 (change log)
Symbol HGNC:MIR7978
DescriptionHomo sapiens miR-7978 stem-loop
Stem-loop
   --uc         gc    c     uccu 
5'     ugguguaua  guug ucaag    c
       |||||||||  |||| |||||    u
3'     accacauau  caac aguuu    a
   auaa         ga    a     cuuu 
Get sequence
Deep sequencing
50 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 21464700-21464758 [-]
sense
OTTHUMT00000360410 ; KCNIP4-001; intron 1
OTTHUMT00000360405 ; KCNIP4-003; intron 1
OTTHUMT00000360407 ; KCNIP4-004; intron 1
OTTHUMT00000360411 ; KCNIP4-009; intron 1
OTTHUMT00000360414 ; KCNIP4-006; intron 2
ENST00000382148 ; KCNIP4-001; intron 1
ENST00000447367 ; KCNIP4-003; intron 1
ENST00000382152 ; KCNIP4-004; intron 1
ENST00000509207 ; KCNIP4-009; intron 1
ENST00000515786 ; KCNIP4-006; intron 2
Database links

Mature sequence hsa-miR-7978

Accession MIMAT0031181
Sequence

1 - 

ucugguguauagcguugcuca

 - 21

Get sequence
Deep sequencing34 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).