Stem-loop sequence hsa-mir-7974

AccessionMI0025750 (change log)
Symbol HGNC:MIR7974
DescriptionHomo sapiens miR-7974 stem-loop
Literature search

2 open access papers mention hsa-mir-7974
(4 sentences)

Stem-loop
   --      cccccac    aa      gccuaaaccaccc     u 
5'   gcucgg       agcg  acggcc             aggcc u
     ||||||       ||||  ||||||             |||||  
3'   cgaguc       ucgu  ugucgg             uucgg a
   cc      ----cuc    ag      ---------auac     u 
Get sequence
Deep sequencing
3493 reads, 21.8 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 11495544-11495622 [-]
sense
OTTHUMT00000421207 ; RGL3-006; intron 18
OTTHUMT00000421238 ; RGL3-007; intron 19
ENST00000562663 ; RGL3-006; intron 18
ENST00000563726 ; RGL3-007; intron 19
Database links

Mature sequence hsa-miR-7974

Accession MIMAT0031177
Sequence

56 - 

aggcugugaugcucuccugagccc

 - 79

Get sequence
Deep sequencing3487 reads, 56 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).