Stem-loop sequence hsa-mir-7973-1

AccessionMI0025748 (change log)
Symbol HGNC:MIR7973-1
DescriptionHomo sapiens miR-7973-1 stem-loop
Gene family MIPF0001693; mir-7973
Stem-loop
   --                    c  a g    u   uc 
5'   ugugacccuagaauaauuac ca c ucuc gag  u
     |||||||||||||||||||| || | |||| |||   
3'   acacugggaucuuauuaaug gu g agag uuu  c
   ac                    a  g g    u   gg 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 51314034-51314109 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-7973-1
hsa-mir-7973-2chr15: 51314032-51314107 [-]
hsa-mir-7973-1chr15: 51314034-51314109 [+]
Database links

Mature sequence hsa-miR-7973

Accession MIMAT0031176
Sequence

1 - 

ugugacccuagaauaauuac

 - 20

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).