Stem-loop sequence hsa-mir-7856

AccessionMI0025526 (change log)
Symbol HGNC:MIR7856
DescriptionHomo sapiens miR-7856 stem-loop
Stem-loop
   u                       uuu 
5'  guuuuaaggacacugagggaucc   g
    |||||||||||||||||||||||    
3'  caaaauuccugugacucccuagg   u
   a                       ucu 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 86357632-86357687 [-]
sense
OTTHUMT00000029335 ; COL24A1-001; intron 31
OTTHUMT00000315891 ; COL24A1-004; intron 32
ENST00000370571 ; COL24A1-001; intron 31
ENST00000436319 ; COL24A1-201; intron 31
ENST00000426639 ; COL24A1-004; intron 32
Database links

Mature sequence hsa-miR-7856-5p

Accession MIMAT0030431
Sequence

3 - 

uuuuaaggacacugagggauc

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).