Stem-loop sequence hsa-mir-7854

AccessionMI0025524 (change log)
Symbol HGNC:MIR7854
DescriptionHomo sapiens miR-7854 stem-loop
Stem-loop
   u       -    - ca       g   --a  u 
5'  uccuucc aucu c  ucaccuu agc   uc u
    ||||||| |||| |  ||||||| |||   ||  
3'  aggaagg uaga g  aguggag ucg   gg c
   a       g    c cc       -   acg  u 
Get sequence
Deep sequencing
318 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 81533902-81533966 [+]
sense
OTTHUMT00000432399 ; CMIP-001; intron 1
OTTHUMT00000432400 ; CMIP-002; intron 1
ENST00000537098 ; CMIP-001; intron 1
ENST00000539778 ; CMIP-002; intron 1
Database links

Mature sequence hsa-miR-7854-3p

Accession MIMAT0030429
Sequence

41 - 

ugaggugaccgcagaugggaa

 - 61

Get sequence
Deep sequencing264 reads, 39 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).