Stem-loop sequence hsa-mir-7853

AccessionMI0025523 (change log)
Symbol HGNC:MIR7853
DescriptionHomo sapiens miR-7853 stem-loop
Stem-loop
      -      ---uca  agg   ug      gu   a  -  a        - -        --      
5' ucu cacacu      au   cau  ucuggg  cuu uu ca augcagau c cugacuuc  acugg 
   ||| ||||||      ||   |||  ||||||  ||| || || |||||||| | ||||||||  |||| u
3' aga gugugg      ug   gua  ggaccc  gaa aa gu uacgucua g gacugaag  ugacg 
      c      ucgucg  gua   gu      uc   c  u  c        a a        aa      
Get sequence
Deep sequencing
39 reads, 12 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 6169304-6169435 [-]
sense
OTTHUMT00000039756 ; F13A1-001; intron 12
ENST00000264870 ; F13A1-001; intron 12
Clustered miRNAs
< 10kb from hsa-mir-7853
hsa-mir-5683chr6: 6169334-6169409 [+]
hsa-mir-7853chr6: 6169304-6169435 [-]
Database links

Mature sequence hsa-miR-7853-5p

Accession MIMAT0030428
Sequence

36 - 

ucaaaugcagauccugacuuc

 - 56

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).