Stem-loop sequence hsa-mir-7852

AccessionMI0025522 (change log)
Symbol HGNC:MIR7852
DescriptionHomo sapiens miR-7852 stem-loop
Stem-loop
                                     uacuac 
5' uaaaugccuuugacuacuacauacauaugccuac      u
   ||||||||||||||||||||||||||||||||||       
3' auuuacggaaacugaugauguauguauacggaug      u
                                     uauacu 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 107897223-107897304 [+]
sense
OTTHUMT00000030339 ; NTNG1-005; intron 2
OTTHUMT00000030341 ; NTNG1-007; intron 2
OTTHUMT00000030336 ; NTNG1-001; intron 3
OTTHUMT00000030340 ; NTNG1-006; intron 3
OTTHUMT00000030186 ; NTNG1-002; intron 3
OTTHUMT00000030338 ; NTNG1-004; intron 3
ENST00000370066 ; NTNG1-005; intron 2
ENST00000370065 ; NTNG1-007; intron 2
ENST00000370074 ; NTNG1-001; intron 3
ENST00000370068 ; NTNG1-006; intron 3
ENST00000294649 ; NTNG1-002; intron 3
ENST00000370067 ; NTNG1-004; intron 3
ENST00000370073 ; NTNG1-205; intron 3
ENST00000370071 ; NTNG1-203; intron 3
ENST00000542803 ; NTNG1-206; intron 3
ENST00000370061 ; NTNG1-201; intron 3
ENST00000370072 ; NTNG1-204; intron 3
ENST00000370070 ; NTNG1-202; intron 3
Database links

Mature sequence hsa-miR-7852-3p

Accession MIMAT0030427
Sequence

60 - 

uauguaguagucaaaggcauuu

 - 81

Get sequence
Deep sequencing20 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).