Stem-loop sequence hsa-mir-7851

AccessionMI0025521 (change log)
Symbol HGNC:MIR7851
DescriptionHomo sapiens miR-7851 stem-loop
Literature search

1 open access papers mention hsa-mir-7851
(1 sentences)

Stem-loop
   u         ca     -c  g  --cc      ug   c   c      uc      a      --g   aua  -    u 
5'  ggcucacug  gccuc  cc cc    cucagg  auc ucc accuca  cuccca guagcu   gga   ca ggug g
    |||||||||  |||||  || ||    ||||||  ||| ||| ||||||  |||||| ||||||   |||   || |||| u
3'  ccgagugac  cggag  gg gg    gaguuc  uag agg uggagu  gagggu caucga   ucu   gu ccac g
   a         ag     cu  a  aucc      gu   a   u      ca      c      aca   -cc  a    c 
Get sequence
Deep sequencing
5775 reads, 837 reads per million, 170 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 42323700-42323859 [-]
sense
OTTHUMT00000403776 ; RP11-630C16.2-001; intron 1
ENST00000550874 ; RP11-630C16.2-001; intron 1
Database links

Mature sequence hsa-miR-7851-3p

Accession MIMAT0030426
Sequence

99 - 

uaccugggagacugagguugga

 - 120

Get sequence
Deep sequencing238 reads, 72 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).