Stem-loop sequence hsa-mir-7850

AccessionMI0025520 (change log)
Symbol HGNC:MIR7850
DescriptionHomo sapiens miR-7850 stem-loop
Literature search

1 open access papers mention hsa-mir-7850
(1 sentences)

Stem-loop
                  ca              ---c    g 
5' ggucagaaguuugga  uaguguggcugggu    cucu u
   |||||||||||||||  ||||||||||||||    ||||  
3' ccagucuucaaaccu  aucacaccgaccca    ggga g
                  ac              uucu    c 
Get sequence
Deep sequencing
58 reads, 64.7 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 2630715-2630793 [+]
antisense
OTTHUMT00000451345 ; GNG7-001; intron 2
OTTHUMT00000451346 ; GNG7-003; intron 2
ENST00000382159 ; GNG7-001; intron 2
ENST00000587867 ; GNG7-003; intron 2
Database links

Mature sequence hsa-miR-7850-5p

Accession MIMAT0030425
Sequence

9 - 

guuuggacauaguguggcugg

 - 29

Get sequence
Deep sequencing44 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).