Stem-loop sequence hsa-mir-7849

AccessionMI0025519 (change log)
Symbol HGNC:MIR7849
DescriptionHomo sapiens miR-7849 stem-loop
Stem-loop
                          a      gc      c  a       gaa 
5' gacuuuauauuguugaacaucag cucaag  caacaa ug cuacuuc   a
   ||||||||||||||||||||||| ||||||  |||||| || |||||||    
3' uugaaauauaacaacuuguaguc ggguuc  guuguu ac gaugaag   a
                          c      ua      a  a       ggu 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 146408583-146408688 [+]
sense
OTTHUMT00000365468 ; SMAD1-003; intron 1
OTTHUMT00000365469 ; SMAD1-004; intron 1
OTTHUMT00000365470 ; SMAD1-005; intron 1
OTTHUMT00000365466 ; SMAD1-001; intron 1
OTTHUMT00000365471 ; SMAD1-006; intron 1
OTTHUMT00000367781 ; SMAD1-016; intron 1
OTTHUMT00000365475 ; SMAD1-012; intron 1
OTTHUMT00000367780 ; SMAD1-015; intron 1
OTTHUMT00000365467 ; SMAD1-002; intron 1
OTTHUMT00000365476 ; SMAD1-013; intron 1
OTTHUMT00000367782 ; SMAD1-017; intron 1
OTTHUMT00000365472 ; SMAD1-007; intron 2
ENST00000514778 ; SMAD1-003; intron 1
ENST00000507594 ; SMAD1-004; intron 1
ENST00000514831 ; SMAD1-005; intron 1
ENST00000302085 ; SMAD1-001; intron 1
ENST00000503324 ; SMAD1-006; intron 1
ENST00000515527 ; SMAD1-016; intron 1
ENST00000507367 ; SMAD1-012; intron 1
ENST00000394092 ; SMAD1-015; intron 1
ENST00000515385 ; SMAD1-002; intron 1
ENST00000514168 ; SMAD1-013; intron 1
ENST00000506626 ; SMAD1-017; intron 1
ENST00000512019 ; SMAD1-007; intron 2
Database links

Mature sequence hsa-miR-7849-3p

Accession MIMAT0030424
Sequence

64 - 

gacaauuguugaucuugggccu

 - 85

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).