Stem-loop sequence hsa-mir-7848

AccessionMI0025518 (change log)
Symbol HGNC:MIR7848
DescriptionHomo sapiens miR-7848 stem-loop
Stem-loop
     u         ug       c    cc   uu     u    ----   u u 
5' gc ggggcuggg  ggugugg aggc  acc  gggua gcaa    agc c g
   || |||||||||  ||||||| ||||  |||  ||||| ||||    ||| | a
3' cg ucuugaccc  ucacacc uucg  ugg  cccau cguu    uug g c
     -         --       a    uc   cu     -    cacu   u a 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 133046481-133046581 [-]
sense
OTTHUMT00000379693 ; OC90-001; intron 10
OTTHUMT00000410190 ; RP11-240B13.2-001; intron 14
ENST00000603859 ; OC90-202; intron 10
ENST00000254627 ; OC90-001; intron 10
ENST00000443356 ; OC90-201; intron 11
ENST00000262283 ; OC90-001; intron 14
Database links

Mature sequence hsa-miR-7848-3p

Accession MIMAT0030423
Sequence

66 - 

cuacccucggucugcuuaccaca

 - 88

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).