Stem-loop sequence hsa-mir-7847

AccessionMI0025517 (change log)
Symbol HGNC:MIR7847
DescriptionHomo sapiens miR-7847 stem-loop
Stem-loop
       c   --   gg    -  u   -     g     c    uag  -     g 
5' gugu ggc  ugu  cgug ac guc ccucu ugucc ccac   gc ccacu c
   |||| |||  |||  |||| || ||| ||||| ||||| ||||   || |||||  
3' uacg ccg  acg  gcac ug cgg ggagg gcagg ggug   cg gguga u
       a   ua   -a    c  c   a     a     a    ---  a     c 
Get sequence
Deep sequencing
1380 reads, 24.4 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 1880045-1880147 [+]
sense
OTTHUMT00000034045 ; LSP1-004; intron 1
ENST00000311604 ; LSP1-004; intron 1
Database links

Mature sequence hsa-miR-7847-3p

Accession MIMAT0030422
Sequence

61 - 

cguggaggacgaggaggaggc

 - 81

Get sequence
Deep sequencing1351 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).