Stem-loop sequence hsa-mir-7846

AccessionMI0025516 (change log)
Symbol HGNC:MIR7846
DescriptionHomo sapiens miR-7846 stem-loop
Literature search

1 open access papers mention hsa-mir-7846
(2 sentences)

Stem-loop
       c  c    ggc    -   -      g -g   g        - u 
5' gccc gc gccu   cucu ggc ccgcug g  cgc ggcuuucg c u
   |||| || ||||   |||| ||| |||||| |  ||| |||||||| | u
3' cggg cg cgga   gagg ccg ggcgac c  gcg ucgggagc g c
       u  -    aga    u   a      g ga   a        u a 
Get sequence
Deep sequencing
182 reads, 4.35 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 12166943-12167038 [+]
sense
OTTHUMT00000367703 ; TNFRSF8-003; intron 3
OTTHUMT00000005130 ; TNFRSF8-001; intron 4
ENST00000514649 ; TNFRSF8-003; intron 3
ENST00000417814 ; TNFRSF8-201; intron 3
ENST00000263932 ; TNFRSF8-001; intron 4
Database links

Mature sequence hsa-miR-7846-3p

Accession MIMAT0030421
Sequence

68 - 

cagcggagccuggagagaagg

 - 88

Get sequence
Deep sequencing142 reads, 51 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).