Stem-loop sequence hsa-mir-7845

AccessionMI0025515 (change log)
Symbol HGNC:MIR7845
DescriptionHomo sapiens miR-7845 stem-loop
Stem-loop
     a   g - -  -         -----       --a    c   -    ccc 
5' gc agg a c ag ggagggucg     uggcgac   cucg gcc agcu   g
   || ||| | | || |||||||||     |||||||   |||| ||| ||||    
3' cg ucc u g uc ccucccagc     gccgcug   gggc cgg ucgg   g
     g   g a a  a         cucca       guc    u   g    cag 
Get sequence
Deep sequencing
908 reads, 4.35 reads per million, 115 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 207166400-207166498 [+]
sense
OTTHUMT00000336458 ; ZDBF2-001; intron 4
ENST00000374423 ; ZDBF2-001; intron 4
Database links

Mature sequence hsa-miR-7845-5p

Accession MIMAT0030420
Sequence

3 - 

aagggacagggagggucgugg

 - 23

Get sequence
Deep sequencing176 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).