Stem-loop sequence hsa-mir-7844

AccessionMI0025514 (change log)
Symbol HGNC:MIR7844
DescriptionHomo sapiens miR-7844 stem-loop
Stem-loop
   u  uugu     c      guaa   aa  u       u  g u    auaa    aauucu 
5'  ga    gcgga ucgugu    gaa  ac aggacug gu g guaa    cuac      c
    ||    ||||| ||||||    |||  || ||||||| || | ||||    ||||      u
3'  cu    ugucu agcaca    cuu  ug uccugac ca c cguu    gaug      u
   a  ---u     a      auug   ca  u       u  a -    -gac    ccucaa 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 94571231-94571352 [-]
sense
OTTHUMT00000408140 ; RP11-74K11.2-001; intron 1
ENST00000550759 ; RP11-74K11.2-001; intron 1
antisense
OTTHUMT00000408126 ; PLXNC1-001; intron 2
OTTHUMT00000408137 ; PLXNC1-011; intron 2
OTTHUMT00000408132 ; PLXNC1-006; intron 2
ENST00000258526 ; PLXNC1-001; intron 2
ENST00000546733 ; PLXNC1-011; intron 2
ENST00000551850 ; PLXNC1-006; intron 2
Clustered miRNAs
< 10kb from hsa-mir-7844
hsa-mir-7844chr12: 94571231-94571352 [-]
hsa-mir-5700chr12: 94561789-94561859 [+]
Database links

Mature sequence hsa-miR-7844-5p

Accession MIMAT0030419
Sequence

26 - 

aaaacuaggacuguguggugua

 - 47

Get sequence
Deep sequencing39 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).