Stem-loop sequence hsa-mir-7843

AccessionMI0025510 (change log)
Symbol HGNC:MIR7843
DescriptionHomo sapiens miR-7843 stem-loop
Stem-loop
        --    aug         cca     c   u  ga 
5' guaga  cagg   agggcagag   gcuuc uga cu  u
   |||||  ||||   |||||||||   ||||| ||| ||   
3' cgucu  guuc   uuccgucuc   cgaag acu ga  g
        cg    gca         uuc     u   -  ag 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 72516820-72516898 [+]
sense
OTTHUMT00000413036 ; RGS6-006; intron 1
OTTHUMT00000413037 ; RGS6-010; intron 1
OTTHUMT00000413038 ; RGS6-011; intron 1
OTTHUMT00000413039 ; RGS6-012; intron 1
OTTHUMT00000413031 ; RGS6-001; intron 2
OTTHUMT00000413032 ; RGS6-002; intron 2
OTTHUMT00000413033 ; RGS6-003; intron 2
OTTHUMT00000413034 ; RGS6-004; intron 2
OTTHUMT00000413035 ; RGS6-005; intron 2
ENST00000355512 ; RGS6-006; intron 1
ENST00000404301 ; RGS6-010; intron 1
ENST00000406236 ; RGS6-011; intron 1
ENST00000407322 ; RGS6-012; intron 1
ENST00000402788 ; RGS6-202; intron 1
ENST00000343854 ; RGS6-201; intron 1
ENST00000553525 ; RGS6-001; intron 2
ENST00000555571 ; RGS6-002; intron 2
ENST00000553530 ; RGS6-003; intron 2
ENST00000554474 ; RGS6-004; intron 2
ENST00000556437 ; RGS6-005; intron 2
Database links

Mature sequence hsa-miR-7843-5p

Accession MIMAT0030411
Sequence

12 - 

gagggcagagccagcuuccuga

 - 33

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7843-3p

Accession MIMAT0030412
Sequence

47 - 

augaagccuucucugccuuacg

 - 68

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).