Stem-loop sequence hsa-mir-7706

AccessionMI0025242 (change log)
Symbol HGNC:MIR7706
DescriptionHomo sapiens miR-7706 stem-loop
Stem-loop
   uggag  g  u       -   -   gga   -  ag 
5'      cu ug gcagggc cag cgc   gcc cg  c
        || || ||||||| ||| |||   ||| ||   
3'      ga gc cgucucg guc gcg   ugg gc  a
   ----a  -  -       u   c   aag   c  cg 
Get sequence
Deep sequencing
1860 reads, 1.09 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 85380596-85380662 [+]
sense
OTTHUMT00000308997 ; ALPK3-001; intron 3
ENST00000258888 ; ALPK3-001; intron 3
Database links

Mature sequence hsa-miR-7706

Accession MIMAT0030021
Sequence

44 - 

ugaagcgccugugcucugccgaga

 - 67

Get sequence
Deep sequencing1820 reads, 84 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).