Stem-loop sequence hsa-mir-7705

AccessionMI0025241 (change log)
Symbol HGNC:MIR7705
DescriptionHomo sapiens miR-7705 stem-loop
Stem-loop
   --aaua      aa             uu 
5'       gcucag  ugucaguucuguu  a
         ||||||  |||||||||||||   
3'       cgaguc  auaguuaagacaa  a
   aaggaa      -a             ug 
Get sequence
Deep sequencing
372 reads, 0 reads per million, 88 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 100702968-100703024 [-]
antisense
OTTHUMT00000277137 ; VPS13B-001; intron 35
OTTHUMT00000277138 ; VPS13B-002; intron 35
ENST00000357162 ; VPS13B-001; intron 35
ENST00000358544 ; VPS13B-002; intron 35
ENST00000395996 ; VPS13B-201; intron 36
Database links

Mature sequence hsa-miR-7705

Accession MIMAT0030020
Sequence

1 - 

aauagcucagaaugucaguucug

 - 23

Get sequence
Deep sequencing319 reads, 83 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).