Stem-loop sequence hsa-mir-7703

AccessionMI0025239 (change log)
Symbol HGNC:MIR7703
DescriptionHomo sapiens miR-7703 stem-loop
Stem-loop
   uuag      u  -au     g   c  g    ggauug 
5'     gggagg gg   gagug ggg ag cagg      g
       |||||| ||   ||||| ||| || ||||       
3'     cccucu cc   cucac uuc uc gucc      c
   -gga      u  ggu     g   -  a    aagaau 
Get sequence
Deep sequencing
62 reads, 4.65 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 24143489-24143565 [-]
intergenic
Database links

Mature sequence hsa-miR-7703

Accession MIMAT0030018
Sequence

55 - 

uugcacucuggccuucucccagg

 - 77

Get sequence
Deep sequencing29 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).