Stem-loop sequence hsa-mir-7702

AccessionMI0025238 (change log)
Symbol HGNC:MIR7702
DescriptionHomo sapiens miR-7702 stem-loop
Stem-loop
   ---                       g  a 
5'    cuuagacugccagacucccugag ac u
      ||||||||||||||||||||||| || g
3'    gaaucugauggucugagggacuu ug c
   ugu                       -  a 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 111271156-111271214 [-]
intergenic
Database links

Mature sequence hsa-miR-7702

Accession MIMAT0030017
Sequence

1 - 

cuuagacugccagacucccuga

 - 22

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).