Stem-loop sequence hsa-mir-769

AccessionMI0003834 (change log)
Symbol HGNC:MIR769
DescriptionHomo sapiens miR-769 stem-loop
Gene family MIPF0000727; mir-769
Literature search

18 open access papers mention hsa-mir-769
(48 sentences)

Stem-loop
   gc     u   --  uu   g        c ug       u   u   g    g   ugu 
5'   cuugg gcu  ga  ccu ggcucuga c  agaccuc ggg ucu agcu uga   u
     ||||| |||  ||  ||| |||||||| |  ||||||| ||| ||| |||| |||    
3'   gaacc ugg  cu  ggg ccgggacu g  ucugggg cuc agg ucga gcu   g
   -c     u   gu  cc   g        u gu       c   u   g    -   cuc 
Get sequence
Deep sequencing
71591 reads, 121 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 46018932-46019049 [+]
sense
OTTHUMT00000459589 ; VASP-001; intron 1
OTTHUMT00000459590 ; VASP-012; intron 1
OTTHUMT00000459591 ; VASP-004; intron 1
OTTHUMT00000459593 ; VASP-003; intron 1
OTTHUMT00000459594 ; VASP-010; intron 1
OTTHUMT00000459588 ; VASP-011; intron 2
ENST00000245932 ; VASP-001; intron 1
ENST00000592139 ; VASP-012; intron 1
ENST00000590603 ; VASP-004; intron 1
ENST00000586014 ; VASP-003; intron 1
ENST00000586619 ; VASP-010; intron 1
ENST00000589627 ; VASP-011; intron 2
Database links

Mature sequence hsa-miR-769-5p

Accession MIMAT0003886
Sequence

30 - 

ugagaccucuggguucugagcu

 - 51

Get sequence
Deep sequencing68049 reads, 152 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence hsa-miR-769-3p

Accession MIMAT0003887
Sequence

69 - 

cugggaucuccggggucuugguu

 - 91

Get sequence
Deep sequencing3307 reads, 129 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).