Stem-loop sequence hsa-mir-765

AccessionMI0005116 (change log)
Symbol HGNC:MIR765
DescriptionHomo sapiens miR-765 stem-loop
Gene family MIPF0000545; mir-765
Literature search

17 open access papers mention hsa-mir-765
(58 sentences)

Stem-loop
   u      gcug    a  ug  --g    guag  agc       ------        cga 
5'  uuaggc    auga ag  ga   uuca    ac   ccuuuuc      aagcccua   g
    ||||||    |||| ||  ||   ||||    ||   |||||||      ||||||||    
3'  aguccg    ugcu uu  cu   aagu    ug   ggaagag      uuuggggu   a
   a      --ag    c  gu  agg    --ag  gaa       gagguc        caa 
Get sequence
Deep sequencing
413 reads, 8.43 reads per million, 83 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 156936131-156936244 [-]
sense
OTTHUMT00000098931 ; ARHGEF11-002; intron 10
OTTHUMT00000098930 ; ARHGEF11-001; intron 11
ENST00000361409 ; ARHGEF11-002; intron 10
ENST00000368194 ; ARHGEF11-001; intron 11
Database links

Mature sequence hsa-miR-765

Accession MIMAT0003945
Sequence

69 - 

uggaggagaaggaaggugaug

 - 89

Get sequence
Deep sequencing399 reads, 76 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).