Stem-loop sequence hsa-mir-760

AccessionMI0005567 (change log)
Symbol HGNC:MIR760
DescriptionHomo sapiens miR-760 stem-loop
Gene family MIPF0000395; mir-760
Literature search

20 open access papers mention hsa-mir-760
(159 sentences)

Stem-loop
   --g   cg    c    u   ucca        c    acc 
5'    gcg  ucgc cccc cag    ccagagcc ggau   u
      |||  |||| |||| |||    |||||||| ||||   c
3'    cgu  agcg gggg guc    ggucucgg cuua   a
   caa   aa    a    u   --ug        -    aag 
Get sequence
Deep sequencing
9252 reads, 9.84 reads per million, 122 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 93846832-93846911 [+]
intergenic
Database links

Mature sequence hsa-miR-760

Accession MIMAT0004957
Sequence

49 - 

cggcucugggucugugggga

 - 68

Get sequence
Deep sequencing8974 reads, 107 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).