Stem-loop sequence hsa-mir-759

AccessionMI0004065 (change log)
Symbol HGNC:MIR759
DescriptionHomo sapiens miR-759 stem-loop
Gene family MIPF0000706; mir-759
Stem-loop
                 cc     u   ag          a   u  cu 
5' uaauaaauuaaaug  uaaac ggc  agugcaaaca uuu ga  c
   ||||||||||||||  ||||| |||  |||||||||| ||| ||   
3' auuguuuaauuuac  auuug ucg  ucacguuugu aaa cu  a
                 aa     -   -g          -   u  ag 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 52810050-52810140 [+]
antisense
OTTHUMT00000471098 ; RP11-64P12.3-005; intron 2
OTTHUMT00000471099 ; RP11-64P12.3-004; intron 3
OTTHUMT00000471093 ; RP11-248G5.8-001; intron 9
OTTHUMT00000045053 ; RP11-64P12.3-001; intron 10
OTTHUMT00000471097 ; RP11-64P12.3-002; intron 15
ENST00000606973 ; TPTE2P2-005; intron 2
ENST00000606043 ; TPTE2P2-004; intron 3
ENST00000451298 ; RP11-248G5.8-001; intron 9
ENST00000403471 ; TPTE2P2-001; intron 10
ENST00000605924 ; TPTE2P2-002; intron 15
Database links

Mature sequence hsa-miR-759

Accession MIMAT0010497
Sequence

24 - 

gcagagugcaaacaauuuugac

 - 45

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).