Stem-loop sequence hsa-mir-718

AccessionMI0012489 (change log)
Symbol HGNC:MIR718
DescriptionHomo sapiens miR-718 stem-loop
Gene family MIPF0000721; mir-718
Literature search

9 open access papers mention hsa-mir-718
(17 sentences)

Stem-loop
   g   g  -   -   aa a   c      ccc      
5'  gcc cg gcg cgc  g ugg ggcggg   gggca 
    ||| || ||| |||  | ||| ||||||   |||| c
3'  cgg gc cgc gcg  c gcc ccgccu   cccgc 
   -   a  a   u   gg c   -      -uc      
Get sequence
Deep sequencing
85 reads, 2.33 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 154019920-154019989 [-]
sense
OTTHUMT00000316139 ; MPP1-011; intron 1
OTTHUMT00000316142 ; MPP1-014; intron 1
OTTHUMT00000316143 ; MPP1-015; intron 1
OTTHUMT00000316140 ; MPP1-012; intron 1
OTTHUMT00000316138 ; MPP1-010; intron 1
OTTHUMT00000061188 ; MPP1-003; intron 2
OTTHUMT00000061191 ; MPP1-006; intron 3
OTTHUMT00000316137 ; MPP1-009; intron 3
OTTHUMT00000316144 ; MPP1-016; intron 3
OTTHUMT00000061190 ; MPP1-005; intron 3
OTTHUMT00000061186 ; MPP1-001; exon 3
OTTHUMT00000127558 ; MPP1-007; intron 4
OTTHUMT00000061187 ; MPP1-002; intron 4
ENST00000453245 ; MPP1-011; intron 1
ENST00000494170 ; MPP1-014; intron 1
ENST00000462825 ; MPP1-015; intron 1
ENST00000475943 ; MPP1-012; intron 1
ENST00000428488 ; MPP1-010; intron 1
ENST00000488694 ; MPP1-003; intron 2
ENST00000369534 ; MPP1-006; intron 3
ENST00000393531 ; MPP1-009; intron 3
ENST00000393529 ; MPP1-016; intron 3
ENST00000369531 ; MPP1-005; intron 3
ENST00000471821 ; MPP1-001; exon 3
ENST00000439370 ; MPP1-007; intron 4
ENST00000417435 ; MPP1-002; intron 4
ENST00000413259 ; MPP1-201; intron 4
Database links

Mature sequence hsa-miR-718

Accession MIMAT0012735
Sequence

42 - 

cuuccgccccgccgggcgucg

 - 62

Get sequence
Deep sequencing15 reads, 12 experiments
Evidence by similarity; MI0004707
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).