Stem-loop sequence hsa-mir-7161

AccessionMI0023619 (change log)
Symbol HGNC:MIR7161
DescriptionHomo sapiens miR-7161 stem-loop
Literature search

1 open access papers mention hsa-mir-7161
(1 sentences)

Stem-loop
   --uaa       -    g   ----     g         aaagu 
5'      agacugu agag caa    cuggu uucucacgc     g
        ||||||| |||| |||    ||||| |||||||||      
3'      ucugacg ucuc guu    gauca gagggugug     g
   ggacc       g    a   ucua     -         ggacc 
Get sequence
Deep sequencing
2792 reads, 107 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 158609707-158609790 [+]
sense
OTTHUMT00000042865 ; GTF2H5-001; intron 2
ENST00000607778 ; GTF2H5-001; intron 2
Database links

Mature sequence hsa-miR-7161-5p

Accession MIMAT0028232
Sequence

1 - 

uaaagacuguagaggcaacuggu

 - 23

Get sequence
Deep sequencing2421 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7161-3p

Accession MIMAT0028233
Sequence

57 - 

uagaucuuugacucuggcagucuccagg

 - 84

Get sequence
Deep sequencing358 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).