Stem-loop sequence hsa-mir-7160

AccessionMI0023621 (change log)
Symbol HGNC:MIR7160
DescriptionHomo sapiens miR-7160 stem-loop
Stem-loop
   --          c     g  c  cg 
5'   ugcugagguc gggcu ug cc  u
     |||||||||| ||||| || ||   
3'   acgauuucgg cccgg ac gg  a
   ag          u     g  a  cc 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 2076589-2076640 [+]
sense
OTTHUMT00000374612 ; MYOM2-015; intron 1
OTTHUMT00000374613 ; MYOM2-005; intron 1
OTTHUMT00000374610 ; MYOM2-003; intron 4
OTTHUMT00000374611 ; MYOM2-004; intron 4
OTTHUMT00000374609 ; MYOM2-012; intron 7
OTTHUMT00000374603 ; MYOM2-002; intron 18
OTTHUMT00000251249 ; MYOM2-001; intron 31
ENST00000523595 ; MYOM2-015; intron 1
ENST00000519268 ; MYOM2-005; intron 1
ENST00000520072 ; MYOM2-003; intron 4
ENST00000519631 ; MYOM2-004; intron 4
ENST00000523443 ; MYOM2-012; intron 7
ENST00000523438 ; MYOM2-002; intron 18
ENST00000262113 ; MYOM2-001; intron 31
Database links

Mature sequence hsa-miR-7160-5p

Accession MIMAT0028230
Sequence

1 - 

ugcugagguccgggcugugcc

 - 21

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7160-3p

Accession MIMAT0028231
Sequence

32 - 

cagggcccuggcuuuagcaga

 - 52

Get sequence
Deep sequencing60 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).