Stem-loop sequence hsa-mir-7159

AccessionMI0023620 (change log)
Symbol HGNC:MIR7159
DescriptionHomo sapiens miR-7159 stem-loop
Stem-loop
   --      aag  ug     ug       -aa u 
5'   uucaac   gg  uagga  gccaggg   g a
     ||||||   ||  |||||  |||||||   | u
3'   agguug   uu  aucuu  cgguucc   c g
   ga      --a  gu     ua       ggg c 
Get sequence
Deep sequencing
734 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 33899135-33899200 [+]
intergenic
Database links

Mature sequence hsa-miR-7159-5p

Accession MIMAT0028228
Sequence

1 - 

uucaacaaggguguaggaugg

 - 21

Get sequence
Deep sequencing708 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7159-3p

Accession MIMAT0028229
Sequence

48 - 

uuucuauguuaguuggaag

 - 66

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).