Stem-loop sequence hsa-mir-7158

AccessionMI0023618 (change log)
Symbol HGNC:MIR7158
DescriptionHomo sapiens miR-7158 stem-loop
Stem-loop
   --               ccug    ---    ----u     
5'   ggcucaaucucuggu    cagc   cuuc     gccu 
     |||||||||||||||    ||||   ||||     ||| u
3'   ccggguuagagauca    gucg   gaag     cggu 
   ac               ---a    agc    ucuuu     
Get sequence
Deep sequencing
120 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 5974662-5974732 [+]
intergenic
Database links

Mature sequence hsa-miR-7158-5p

Accession MIMAT0028226
Sequence

1 - 

ggcucaaucucugguccugcagcc

 - 24

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7158-3p

Accession MIMAT0028227
Sequence

51 - 

cugaacuagagauugggccca

 - 71

Get sequence
Deep sequencing104 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).