Stem-loop sequence hsa-mir-7157

AccessionMI0023617 (change log)
Symbol HGNC:MIR7157
DescriptionHomo sapiens miR-7157 stem-loop
Stem-loop
   --  ag      u      c    augaaa 
5'   uc  cauuca uggcac agag      u
     ||  |||||| |||||| ||||      u
3'   ag  guaggu aucgug ucuc      g
   ug  aa      c      -    cucagg 
Get sequence
Deep sequencing
97 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 140586626-140586685 [-]
intergenic
Database links

Mature sequence hsa-miR-7157-5p

Accession MIMAT0028224
Sequence

1 - 

ucagcauucauuggcaccagaga

 - 23

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7157-3p

Accession MIMAT0028225
Sequence

39 - 

ucugugcuacuggaugaagagu

 - 60

Get sequence
Deep sequencing82 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).