Stem-loop sequence hsa-mir-7154

AccessionMI0023614 (change log)
Symbol HGNC:MIR7154
DescriptionHomo sapiens miR-7154 stem-loop
Stem-loop
   --     g    gg    ag    gag   ug  ag g 
5'   uucau aacu  gucu  cuug   ccu  gu  g a
     ||||| ||||  ||||  ||||   |||  ||  |  
3'   gggug uuga  cagg  ggau   gga  cg  c a
   ua     -    -a    -a    aga   gu  aa g 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 45691704-45691776 [-]
intergenic
Database links

Mature sequence hsa-miR-7154-5p

Accession MIMAT0028218
Sequence

1 - 

uucaugaacugggucuagcuugg

 - 23

Get sequence
Deep sequencing61 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7154-3p

Accession MIMAT0028219
Sequence

54 - 

aggaggacaaguugugggau

 - 73

Get sequence
Deep sequencing79 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).