Stem-loop sequence hsa-mir-7153

AccessionMI0023613 (change log)
Symbol HGNC:MIR7153
DescriptionHomo sapiens miR-7153 stem-loop
Stem-loop
   uga      acaaa      ag    uc a 
5'    gaacug     uguggu  gugg  g a
      ||||||     ||||||  ||||  |  
3'    uuuggc     guacca  cacc  c g
   cca      ---ag      --    ua u 
Get sequence
Deep sequencing
195 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 11654885-11654941 [-]
intergenic
Database links

Mature sequence hsa-miR-7153-5p

Accession MIMAT0028216
Sequence

1 - 

ugagaacugacaaaugugguagg

 - 23

Get sequence
Deep sequencing190 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-7153-3p

Accession MIMAT0028217
Sequence

40 - 

caccauggacgguuuacc

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).